Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93061.3.peg.1958 Phage phi 11 orf61 protein homolog [Staphylococcus aureus subsp. aureus NCTC 8325]
gtgaatgatttacaagagagagaattagaaacattcgaacaagacgaccgattcaaagta
actgatctagacagtgctaactgggtttttaagaaactggatgcaatcacaactaaagag
aatgaaatcaacgatttagcaaataaagaaattgaacgcataaacgaatggaaagataaa
gaagtagaaaaattacagagtggcaaagaatatttacaaagccttgtaattgaatattac
agaatacaaaaagaacaagatagcaaattcaagttgaatacaccttacggaaaagtgaca
gccagaaaaggttcaaaagtcattcaagttagcaatgagcaagaagtcattaaacaactt
gagcaacgaggttttgacaactatgtaaaagtaactaaaaaacttagccaatcagacatt
aagaaagatttcaatgtaactgaaaacggcacattgattgacgcaaacggcgaagtttta
gagggtgctagcattgtggagaaaccaacgtcatacacggtaaaggtgggagaatag