Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|904782.3.peg.2764 L-Cystine ABC transporter, periplasmic cystine-binding protein TcyA [Staphylococcus aureus subsp. aureus IS-111]
atgaaaagacttttatttgtgatgatagctttcgttttcatattggctgcatgcggaaac
aattcgtcgaaagacaaggaagctagtaaagatagcaagacaattaatgttgggactgag
gggacttatgcaccatttagtttccacgataaagatggtaaattaactggttacgatatt
gatgttattaaagcagtggctaaagaagaaggtttaaaacttaaatttaatgaaacttct
tgggattctatgtttgcaggtttagacgcagggcgttttgatgtaatcgcgaaccaagta
ggtattaatcctgatagagaaaagaaatataaattttctaagccttacacattctcaagt
gctgttttagttattcgtgaaaatgaaaaagatattaaagattttgatgatgttaaaggt
aagaagttagcacaaacattcacatctaattatggtaaattagctaaggataaaggtgct
gatattacaaaagttgatggctttaaccaatcaatggatttattattgtctaagcgtgtt
gatggtacatttaatgatagtctgtcatacttggattataaaaaacaaaaacctaatgct
aagatcaaagcaatcaaaggtaatgctgaacaaagtagatctgcatttgcattttctaaa
aaagcagatgatgaaacagttcaaaaattcaatgatggcttgaaaaaaatcgaggaaaac
ggtgaattagctaaaataggtaagaaatggtttggtcaagatgtttctaaatctaaatag