Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|875328.3.peg.3368 Mycofactocin system heme/flavin dehydrogenase [Mycobacterium sp. JDM601]
atggctcgtgatatctggttcgaaaccgtcgccatcgcccaggagcgagcgcgcaaacgc
ctcccgaagtccgcgtactcgtcgctgatctcagccagcgagaagggcgtgaccgtctcc
gacaacgtcgaggcgttcagcgagctgggtttcgctccgcacgtggtcggcgcgtgcgag
aaacgtgatctgtcgactaccgttatgggccaggagctttcgtttccggtaatgatctcg
ccgacgggcgtgcaggcggtcgacccggacggcgaggtcgccgtcgcgcgggccgccgcc
gcgcgcggcaccgctatgggcctgtcgtcgttcgccagcaagccgatggaagaggtcatc
gccgccaaccccaagaccttcttccagatctactggctcgggggccgcgatgcgatcgcc
gaacgcgtcgagcgcgcccgggccgccggtgcggtgggcctgattgccaccaccgattgg
tccttctcgcacggccgggactggggaagccccaaaatcccggagcagatggatctcaag
accatgatcaagatgatgcccgaggccctgggccggccgcggtggtttttgcagtgggcc
aagaccctgcgcccgccgagcttgcgggtgcccaaccagggccgacgcggcgaaccgggt
ccgccgttcttccaggcctacggcgagtggatgggaacaccgccgccgacctgggaggac
atcgcgtggctgcgcgaactctggggcgggcccttcatgctcaagggtgtcatgcgggtc
gacgatgcgaaaaaggctgtagacgctggagtttcggcgatctccgtgtcgaaccacggt
ggtaacaacctggacggcacaccggcggcgatccgggcgctgcccgctgtcgccgaggcg
gtcggcggccagatcgatgttttgctggatggtggcatccgacggggcagcgacgtcgtc
aaggcggtggcgctgggcgcccgggcggtgatgatcggccgcgcctacctgtgggggctg
gccgcggccggccagcccggggtggagaacgtcctcgacatcctgcgcggcgggatcgac
tcggccctgatggggctcgggcgggcctccgtgcacgatctgtcgccggacgacatcctg
atcccgcccggtttcgcccgcgcgctcggtgtgccctccgacggaggccggtag