Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|762051.3.peg.1860 Phage antirepressor protein [Leuconostoc kimchii IMSNU11154]
atgaacgaagtagcagtatttaattttgaaacaaacgaagtaagaacagtagtgattaac
gaagaagtttggttagttgctaaagatgtagcaaccacgttgggatattctcgaacagct
gatgctgttaaagcacatgttgacgaagaagataaaggggtcggtaaaatacagaccccc
ggtggaacacaacgaatgacagtcattaaccaatcaggcgttatctcgttagcactatca
agcaaactgccaacagctaagaaattcaagcgttgggtaacatcagaagttattccgagt
gtattgaaacatggtagttactcaaaaccacaaagcacattgcaactatttgataacgcg
cttcaagtgatgaaagaacaagaaaccaaaattaaccacgtagttgatcgaatggatgag
tttgaagacgcacaggaaatcagaagctgggagcagactgaattattgcgcatgagaaaa
aacaaggtgtttgcaattctagggagtaaacatacgaagcgatataaggcattatccagt
gaagtataccaatcaattagtcatgactttaaatcacagtttaacgtgccaagatataac
gcgttgccacgaaagcaatttgaagacggcaaacggttcttcattaattgggaaccgagt
aacttattagaacttgccataaagggcgcagaacaaccagcatag