Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|682148.3.peg.1122 Phage antirepressor protein [Gardnerella vaginalis 5-1]
atgaatgaattacaagtatttaagaatgtagagcttggctctgttcgcacaacagtagta
gatggtatcccatattttgtgggcaaggacgtggctgagattcttggttatcgtgataca
tctgatgcactgaaaaggcatgtagatgaagatgataagctgactcggtgtttcaccgac
tcaggtcagaaccgagaaatgtatgttattaacgagtctggtctttacagtcttattctt
agaagtcagctccctaaagcgtgtcagtttaaacgatgggttacatcacaggttcttccg
agtatccgtaagcacggtatgtatgcgacagatgagcttatcaacaatcctgatatggct
atcgctgtttttaacgcattgaaagaagagcgtgctaaaagagaagcgttagagcttacg
actgctgtgcaaaaacagcagatagctgagcttaaaccgaaagccagctattacgatgtt
gtgcttaaatgcaaagacataatctctatgcgtgtgattgcaaaagattatggcaagtca
gcacagtggatgaataactttttgcatgagctcggtgtgcagtataggcagtctgatatc
tggcttttatatcaaaagtatgccaatcaggaatatacgaaatctcgcacaaatacatac
gaggattctaatggtgttacacactcaaaaatgcatacttattggactcagaaaggcagg
cttttcatctatcacctcatgacacaacacggtatctacccgttgattgaacaggaggct
aaagatgagtaa