Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|663951.4.peg.2124 Hypothetical protein, PVL orf39 homolog [SA bacteriophages 11, Mu50B] [Staphylococcus aureus subsp. aureus TW20]
atgtattacaaaattggtgagataaaaaacaaaattataagctttaacgggtttgaattt
aaagtgtctgtgatgaagagacatgacggtatcagtatacaaatcaaggatatgaataat
gttccacttaaatcgtttcatgtcatagatttaagcgaactatatattgcgacggatgca
atgcgtgacgttataaacgaatggattgaaaataacacagatgaacaggacaaactaatt
aacttagtcatgagatggtag