Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|642492.3.peg.828 BRO, N-terminal [Clostridium lentocellum DSM 5427]
atgaataaagaattaaatcaggcattggctacaggtaataatactccagtagtgctaatc
ggtaaaaatggacaagctattgaaactataagcagcatagaagtatcagaaatggtagaa
aagccacacaacgatttattaaaggatattagaagatatattactcaattagccgaggga
aatctttcccacagcgaattctttattgaaagtacatatttagatgcaaatagacaaagt
agaacatgttatcaagttactagaaaaggttgcgaactaattgcaaacaagcttatagga
acaaagggcacatgttttacagcaagatatgtaaatagatttcatagcatggaaaactac
ataaaacaaaaagaatcatatcagattgatgatcccattgaacgtgctaaagcttggata
ttagaacagcaagaaaagcaagtattacaactagaaaataagcagcaacagcagataatc
ggcgagcttcaacctaaagcatcctattacgatttagtattacaaagtacggaactcatg
cctattactttaatagctaaagactacggcatgagtgcaaatgcaatgaataaaacacta
tttaatctaaatgttcagtataaccaatcaggtacatggcttttatatgcaaagcatcac
gctaaaggatacacacaatcaaagacacaaacttatacaagaggtgatggttcaactgga
attaagcttcatactcagtggacacaaaaaggaagactatttctttattctttattaaaa
gaaaatgggattttaccagttatagaacgtgaagatggaggacaagcataa