Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|637389.3.peg.933 Phage antirepressor protein [Acidithiobacillus caldus ATCC 51756]
atgagcaccgaactgatcccgtttgatttcgaaggccgtccggtccgggtcgtcacggat
gcccaaggcgaaccgtggttcgtcgcggcggatgtgtgcgcggttcttgaactgccgaac
accacccgcgccctggcgcgactggaccctgacgagcaagccctgatctcgattcagggc
atctcgcgcggcaatgaccaggtcaacgtcgtcaacgagcccgggctgtacagcctggtc
ctcggcagccgcaagcgcgaggccaagcgcttcaagcgctgggtcacccacgaggtgctg
ccggcgatccgcaagacgggcagctacacggcgccaagtgcacgcccgaccctgccggca
cccacccaggaccgcgtcgccgctctgctgctgatcggcgaggccgtggccaaggtgccg
ggggtcaagcccggcatcgcgatggcggccacgctcacctgcatccaggagaacacgggc
ctggcggtcgagacgctgcgccgcgcccttcctgcccgggacactgcggcgaacgaggcg
atctgctcgctcaacgccacccagctcggcaggctgctcggcctgtcggccaaggccatc
aaccagcgcctggcccaccacggcctgcagttgcgcaacgaacgcgacgagtgggaactg
accgaggccggcgaggcctgggccgaggcgatgccgtactcccgcaacgggcacagcggc
taccagatcctctggaaccctctggtggtcgagcggctgaaggaggtggcgtga