Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|634994.3.peg.765 Phage antirepressor protein [Leptotrichia hofstadii F0254]
atgagaaatgaattaacagtatttgaaaatgaaaaattcggaaaagtaagagtagttaca
gaaaatgaaaaaccttatttcaatttaaatgatgtatgcgagattttaggattaaaaaat
cctagacaagtaaaatcaagactaaatccaaagggcgtcattttggtggacacccttaca
agtggcggaaaacagcaaatgaattttataaatgaaagtaatttatataaatgtatattc
caaagtgataaacctgaagcagaagcaattacagagtgggtaacaggagaggtattgcca
acaatcagaaaaacaggaatgtatgtaacagatgaactattaaataatcctgatttagct
ataaaagcctttacgagattgaaagaagagcaggagaaaagaatgcgtttagaaaaagaa
atagaagagcaagctccagcagtcgcttttgcaaattccttgacagtatccaaagattgt
attttagttagagagctatcaaaaatattaaagcaaaatggaattgatgttggagaaacg
agattatttgagtggttaagacaaaatggatatttaatttcaaaagtaggctctgattgg
aatttgcccacacaaaaatcaatgaatctagggctattcgtgataaaagaaggcactagg
atgtcaacaacagagggttcaaaaattacaaaaactccaaaagtaacaggaaaaggacag
caatatttcctgaataaatttttaaaaaataacagacttatggaggtaaattaa