Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|634956.3.peg.3692 BRO domain protein [Geobacillus thermoglucosidasius C56-YS93]
atgaatacgatccgaatcgaggaatggaacggacatcaaattcggtttatcgaaaagtta
cctggcgattggtgggcagtagcaaaggatgttgcgtcggctcttggttataaccataca
ccaagcatggtgagaatgttagaccaagacgaaaagggtgtacacattctgcacacccct
ggcggaaatcaaaaaatgacaatcatttcggaaacagggatttacgaggctatttggaac
agcagaaagccggaggcaaaagacttcaaaaagtgggttaaacaaacgatcaaggcactc
cgacaagcgtccggtctcgaaggattccaagtctttcgcatgttagacaaagatcatcaa
aaagaaatgatgcgaaaactcagagaatcactcaaccaaccgggacgggtggactatatc
aaagccaacaccatagcaaacaaggcagtttctgctaaatacggctatccgaaaatggtc
aagaaaaacgaaatgacaccggatatgctgattgaccgccagcagattttagaggataca
gtcaatcttatggttgtcaaagaaaagtttggtcttgatatatcagttagcaagactgtt
tacgataagtacatttcgtga