Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|596326.3.peg.2602 Integrase [Lactobacillus jensenii 208-1]
atggcacaaattattaaaaaagacaatggttggactataagatattcacatcgtgttgga
aaatctttaagtcagaaatacaaatcaggttttaaaactaaagctgaagcacaagcatat
attgctaagcttgaacagatgaaacaagcaggactaaagtttgatgtaaatcctagctta
gttgaatattatcaaaactgggtagatacttacaaaaaagccaaagttacactatctact
tatcaggattatcagctaaatggtaagcgccttgaaaactactttggcaaaactaaaatg
aaaaacataactcgatcagcctatcaagaatttattaacgattttggaaacaatcatgct
aaaaatactgtacacaagttaaataattgtgttaagtcttgcgtgcagtcagcactttat
gacggaattattaccaaagacttcacacacaacattaatatatcttttaatgctgataaa
gccttgaaagttgaatatctaagcatagctcaaattaaagcattgataaactacgaaact
aaaacacgaaagccacttagaccaaacaattacttaataattgctgcactctattctgga
gcacgattgagtgagcttactggattaacctggaatgatattgacgtgtatggtaatact
tttagtatttctaaaacctggaactatagaaccaagcaatttggaccaacaaaaaatgag
agtagtgttcgcaagatatcagtaccaaaaaagctaattgatttactactggaactaaaa
gttaaccgctcagactttgttttctggtctgcaactcaccaaggattgccaaactcgcac
acagctaataaggcgctaaaacgtgcgcttgattctcttaatattgctaagcgtgatttt
cactttcactcgctaagacactgccatgttgcctttcttttatctcaaggcatccccatt
gatggtatagcaaaacggttaggacatgctaatgtgatcacaactatgaaaatttatgca
tacttaattgatgaatatcgtaacaatttaagtaatcaaattgtggataacttaaatgcg
ttgtaa