Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585397.7.peg.2551 Phage DNA binding protein Roi [Escherichia coli ED1a]
atgaatgagctgataaatagcagcatcatcaaaatgaccagcattgaaatcgctgagttg
gtggggagtcgtccagataacgtaaaaatatcaatagagcgcctggctaaatctggagtt
attcaacttcctgcattgcaggttttcgaaaaaatcaataacttaggactgcgccgtagt
gtcgaggcttacgtcttcgaaggcgaacaaggtaagcgagacagcattattgtcgtcgcc
caattgtcgccggaattcaccgctcgtcttgttgaccgttggcgagagcttgaagaaact
gcggttaatatccccaaaacgctaccagaagcgttgcgccttgctgctgatcttgctgag
cagaaaatgcaactggaaaaccagctcgcaattgccgcacctaaagttgagtttgccgat
cgagttggcgaggccagcggaattttgattggaaactatgcaaaggttgttggaattggt
ccaaacaaactgtttgcgtggatgcgcgatcacaaaatccttattgcttcaggtgcccgg
cgcaatgtgccaatgcaggaatatatggagcgcggctatttcacagtgaaagaaacagcg
gtcaacacaaatcacggaatacagatatcgttcaccacaaaaatcaccgggcgtggtcaa
cagtggctgaccagaaagctgctcgataacggaatgctgaaagtaacaggggaggctgct
taa