Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585396.4.peg.1191 Putative DNA-binding protein Roi of bacteriophage BP-933W [Escherichia coli O111:H- str. 11128]
atgaatgagctgataaatagcaatgccatcaaaatgacaagcattgaaatcgctgagttg
gtgggaagccaacacggtaatgtcagaatatcaatagaacgtctggcaaagcgtggggtg
attcaacttccttcaatgcaaaaagttgaaaataaacaaacaattagccctaacaaattc
acaagcgtgtatatattcgaaggcgaacaaggtaagcgaggcagcattattgtcgtcgct
cagttgtcgccggaattcaccgctcgccttgttgaccgctggcgagaactcgaaggggca
accgcgaaaataccacaaaccttttctgaggcattgcgccttgcggccgaccttgaagac
cagaaggctgaactggagaaacagcttgctctcgcagcacctaaagttgagtttgccgat
cgagttggcgaggccagcggaattttgattggaaactttgcaaaggttgttggtattggt
ccaaacaaactgtttgcgtggatgcgcgatcacaaaatccttattgcttcaggtgcccgg
cgcaatgtgccaatgcaggaatatatggatcgcggctatttcacagtgaaagaaacagcg
gtcaatacaaatcacggaatacagatatcgttcaccacaaaaatcaccgggcgtggtcaa
cagtggctgacaagaaagctgctagataacggaatgcttaaagtaacaggggaggctgct
taa