Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585199.3.peg.408 Phage antirepressor protein [Mobiluncus mulieris ATCC 35243]
atgggaaaccagattcaaacattcaccaacgacgtgttcggcaccatccgcactatcacc
aatgatggtcagatccttttctgcggcaaggatgtcgccaccgcgctcggctaccaggat
ccgacgaacgcggtgaagctgcactgcaagggggtggcaaattaccacccccttgagacc
gctggcggaatccagcaggtccgcttcattaccgagggcgacctctaccgcctcatcatt
tcttcaaaactcccggcagcacagaagttcgaagcctgggtgttcgatgaggtgttgccg
acgattcgccgccacggcatgtacgcatacgacgaactactcgctgacgatgagttcctg
gagcatgccatcgccactctgcgggccgagcgagccaagcgcctcgccgcagagcaatcc
ctgttggaggcggcaccgaaagtctcgtactacgacgtcgtgctgcagtccgattcgttg
ttgacgacgacggcgattgcgaaggactacggactctccgcgaagaagctcaaccgaatc
ctgcgtgatgctcacgtgcagttccatcagtcgggccggtggttcctctacgcgaagtac
gccgagcagggctacacccagtccaagactcacgaatacgacgaaggccagacccgcacc
cacatgtactggacccagaaggggcgcttgttcatctacgacctgctcaagaacaagctc
ggcatccttccggtgattgagcgtgaaggtcaggtgcaagcatga