Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585153.3.peg.2612 Hypothetical protein, phi-ETA orf24 homolog [SA bacteriophages 11, Mu50B] [Staphylococcus aureus subsp. aureus E1410]
atgccgaaagaaaaatattacttataccgagaagatggcacggaagatattaaggtcatc
aagtataaagacaacgtaaatgaagtttattcgctctcaagagcccatttcagcgacgaa
aagaaaattatgactgatagagacctaaaacgatttaaaggcgctcacgggcttttatat
gagcatcagttaggtttgcaggcaacgatatttgatatttag