Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585152.3.peg.1832 Phage phi 11 orf9 protein homolog [Staphylococcus aureus subsp. aureus D139]
atgaacgcactatacaaaacaaccctcctcaccacaatggcagttgtgacgtggaaggtt
tggaagattgaacgaaatacgagaaagcctgtaatcaatcggaatgattttagtaaagag
tctacagcagaaacgattgagcgacacagtgatcctgattcaggaataaaactacttaag
gcattttccgacttcactaaacaagctgaaaagcaaaaacctacactaggagaagtttat
agacggaacaaacctgaattaccaaccgttactttagacgaaaacggactgtttataaat
gattttagggtgccttatgtacttgaggaaggggttaacgtaaagaaatctatgaacaac
ctatataaggtcagtttggactttttcgctaaaagtattattgcagataattacgaagca
gataacccagagaatcaacagttattttaa