Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|575607.3.peg.1536 Phage antirepressor protein [Lactobacillus jensenii SJ-7A-US]
atgattgtaattagtgagtcaggcttgtatagcttaattctttcaagcaagttaccaaca
gccaagaaattcaagcactgggtaactagtgaagtcttaccagctatccgcaaacacggc
gcttatatgactgatgaaaaggcatttgatgttgttaacaataaatcaggtttagctgat
ctattacagcaagctgcagaccaattaaagcaaaaggacattcaaattgctgaactcaag
cctaaagcattgtttgctgatagcgtagcaacttcagactcaactatcttagtcggtgaa
ttagccaagattttgcgaggcaatggaattgagataggtcagaataggctgtttgattgg
ctgagaactaatggctacttgatttccaagaagggtagtagttacaacttaccaacccag
aaatctatgaacttgggcttgttcaagattaaggaaaccactattaatcatttcaacggc
tcagtatcaattagtaagacagctaaggttactggaaaaggtcagcaatactttattaac
aagtttctgaattgtgcaaaggtgaccttctttggctcagataagaaattagtgacatat
gttgatgcgcaaaaacatcccaaacaaaaaaagtcctag