Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|575604.3.peg.972 hypothetical protein [Lactobacillus gasseri SV-16A-US]
atgaagtttgatttgcaacgtttaaaaggtgagcgtgtagcacgaggaattacacaagct
caaatggcacgtaaaataggcattagtacgaatgcctattggagaaaggagaatggagaa
cgtgacattggtatggaagaatttgtcaagatcttaagtgtactaggtttcgaaaagaaa
caaatttcgcttttttttgcaaaagacgttcacaatagtgaacattaa