Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|572547.3.peg.1169 Phage antirepressor protein [Aminobacterium colombiense DSM 12261]
atgaaggggctacagatctttgagttcgagaatcaagatgtgcgggtgcgcattgatgag
gcggggaatccgtggtgggttgccagggacgtatgtgatgtgttgggatacagcaatgca
agggacgctgtaaacaatcacgtcagaattaaacatagagatgctgtcgcaattcccgac
gccatgggacgaaatcaacttacctcggttatatctgagccaggtctttattccctggta
ttacgttcaaagcttccttcggccgtaaggtttcaagactgggttacagaagaagttctt
cccgccatacgcaagcatagcgcctacctaactccacaaaaaatagaagaagttttatgc
aaccctgacacgattatccggttggcgactgaccttaaaaaagaacgtgagcaacggttg
cgacttgcttcgaaggtgagggaagatgctccaaaagtgatctttgctgagagtgtttcg
gcgtcacatacgtcaattcttgtaggagatctagctaaattattacgtcaaaacggcatt
cagatggggcagaacaggttgtttgattggctgagacgcagaggctatctcataaagtcc
ggaagcagcagaaacatgcctacccaacgggccatggagctggggctgtttgagatcaaa
gagcgaaccattaataatcctgatgggagcgtgagaattaccagaacgccaaaggtaacc
gggaaggggcaaatatactttgcaaatatatttctgaacgaggtgtcggcatga