Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|557433.3.peg.823 transcriptional regulator, XRE family [Lactobacillus reuteri JCM 1112]
atgtcacaattccaattagcaaaagtattaggaattggaacaagcactttaggaatgtac
gaaacgaataaaagaaagcctagccctaaagtcttaaataaaatagctgattatttcgat
gtttctactgattatttattagggcgcaagagtaaagcagatcaagtacataatgcgact
gttgatgaagctctcggaacaattatgtcattcgaaggccaacccgttactgaacatgat
aagaaagtaatgaaagatttactagaaagttatctcagaaataaagagtaa