Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|548485.3.peg.1546 Phage antirepressor protein [Lactobacillus reuteri MM4-1A]
gtgaacgaaccacaattatttaattttcatggacaacaagtccggacaatgacgcttaac
gatgaaccatattttattggacgtgatcttacggctatcctccagtattcaaatggtcca
aaggcaatccgagaccacgttgatgcagatgacaagctgactgaacgaatcgttctggca
ggccaacatcgagaggtaacactcatcaatgaatcgggtctttattcattaatccttggt
agcaagttaccaaccgccaaagaattcaagcactgggtaacaagtgaagtgctaccagcc
atccgtaagcatggtgcctatatgacaccacaaacgattgaaaaagcgctgcttaatcca
gatacaatcattaatcttgctactcagttaaaaagggaacaagagcaacgtaagcaactt
caagcagagaacgagcagatgaagccaaaggcactgtttgcggacgcggtttctacaagc
aactcaagcattctaattggacagcttgccaaaatccttcgccaaaacggagtaaatatt
gggcaaaatagactgtttgcttggatgagaaagaatggctacttgggaacaagaggaagt
aatcgtaatgttcctactcagcgttcgatggaattaggcctgtttaagactaaagaaaca
gtaattaatcattctgatgggcatacaactgtcaacattacaacgaaagtgactggcaaa
ggacaacaatatttcattaataagttcttaaatgcaccagtaattgaggcttag