Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|548478.3.peg.580 Phage antirepressor protein [Corynebacterium glucuronolyticum ATCC 51866]
atggctaccgcgctacatgcgttcaccaaccacgagttcggtacgatccgaaccatcacc
tcgggcgggcaggtcctgttctgcggcaaggacgtggcgaccgccctcggctacgccaac
acgaaagatgccctggcgcgtcactgcaagggggtggtcgtgaatcactaccccctagaa
acggctggcggcatccagcaggtcaggttcatcagcgaaggcgacccgtaccggctgatc
gtctcctccaagctgcccgccgcccggcagttcgaggcgtgggtgttcgacgacgtcctc
ccgtccatccgccttcacggcatgtacgccatcgacgagctgctcaatgatgatttgttc
ctggagcgagcaatcgccgccctgcgcgccgagcgggccaagcggctcgccgccgagcaa
gcactgctggaggcggcaccgaaggtgtcgtattacgacgtgatgctggtgtcgccgtcg
ctgatcaccaccaccgagatcgccaaggactacggcttgtcggcgaagaagctcaaccag
attctgcgcgaggagcaggtgcagtttcaccagtccgggcgctggttcctctacgccaag
tttgctgagcagggttacacccagtccaagacgcacgagtacgacgagggcaagacccgc
acccacatgtactgggcgcagaaaggccgcctgttcatctatgacctgttgaagaacacc
cgtggcctgccaccggtgatcgagcgtgaaagcgaggacaccaaatacccaccactgcgc
ttcttgataccggaataccgaagaagaacgtcgaaggataccccgacccgacctgctacc
gcgcgctga