Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|546342.3.peg.1520 L-Cystine ABC transporter, periplasmic cystine-binding protein TcyA [Staphylococcus aureus subsp. aureus str. JKD6008]
atgaaaagacttttatttgtgatgatagctttcgttttcatattggctgcatgcggaaac
aattcgtcgaaagacaaggaagctagtaaagatagcaagacaattaatgttgggactgag
gggacttatgcaccatttagtttccacgataaagatggtaaattaactggttacgatatt
gatgttattaaagcagtggctaaagaagaaggtttaaaacttaaatttaatgaaacttct
tgggattctatgtttgcaggtttagacgcagggcgttttgatgtaatcgcgaaccaagta
ggtattaatcctgatagagaaaagaaatataaattttctaagccttacacattctcaagt
gctgttttagttattcgtgaaaatgaaaaagatattaaagattttgatgatgttaaaggt
aagaagttagcacaaacattcacatctaattatggtaaattagctaaggataaaggtgct
gatattacaaaagttgatggctttaaccaatcaatggatttattattgtctaagcgtgtt
gatggtacatttaatgatagtctgtcatacttggattataaaaaacaaaaacctaatgct
aagatcaaagcaatcaaaggtaatgctgaacaaagtagatctgcatttgcattttctaaa
aaagcagatgatgaaacagttcaaaaattcaatgatggcttgaaaaaaatcgaggaaaac
ggtgaattagctaaaataggtaagaaatggtttggtcaagatgtttctaaatctaaatag