Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|537021.9.peg.4 Phage antirepressor protein [Liberibacter asiaticus str. psy62]
atgagcactataaccccttttgaatttgaaagcaacaagatccgtactattgtggataaa
gaccagaatatatggtttgtggctaaagatgtcgctacggctttagggtatgaaaattca
aatgaagcaataaacgctcattgcaagggggtagcaaaacgctacccccttaagactgaa
ggcggaatacaaaaagtccgtatcatatcagaacctgatgtttacaggttactggttaaa
agcacgttaccatcagcacagaagtttgagcgttgggtatttgaggaggtgttacctact
cttcgcaaaacaggcagttattcggttgaagcaccgaagcttagagccacttcagcgagt
acagttttaagagttcacaaacatcttgaagaactagccaagcaagcaggattaaaagac
aatcaacttttgttgaaggttaaccgaggcgttacgaagataacaggtgttgatcagtta
gaggctatggatatcaaacacctaccctcttccgataacgacgaatatttaacaattacc
caaataggggaaaggcttaacccacctcagagagcgagatttttaaacaaacttcttctt
aagcgaggactgcaagttagcaaggtctcaggtggctatagaccgacacctaaaggtgaa
gagcgtggaggcaagatgtgtgatgtgcccatgcagcatgttgaaggctcaacccagcaa
ttaaaatggaattcgaatttactcgtttcgtttcttcaaaacgaattaattaacacacca
cgcctataa