Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|537011.5.peg.5140 Phage antirepressor protein [Prevotella copri DSM 18205]
atggtaaagtcagttaatacaaataaagtagaaatggataagaaggcagcaattgctgtt
gtgtttgaaaaccctgaattcggtaagattcgtaccttgaccgatgaaaatggggagcct
ttgttctgcgcaaaggatctctgtgatatactggggtataaaaaatcaagaaacgctgta
aatcagttggttaaccaccttgacgccctaaaacagggcgtcaaggtatcgggaagcctt
cgtaaggatggaagccgaacagtacgaactcagcagatgatcttcgtcaacgagagcggt
ttctatgctttggtgctcggctccaagctttctactgccgtgaagttcaagaactgggtt
acggctgatgtgctgccacagattcgcaagacgggcggttatattccggttcagccgggc
gagagcgatgaggagacaatccgacatgcggaagaaattctccgtgctacgctcaaggag
aaggagaatctgctgaagaaacagcgcctgcagattgagcagcagaagaagcttatcggc
gaacaggatacagaaatccgccgcttgaatgatgtggtggatgagcaggtggttcgcatc
gccaagagtggtgataacatcatccagttggagaatcaggtgggtaatcttttgccgaaa
gcgctctatagcgataacgtgctcgattccgtttcttgcttcaccaccacgcagattgcg
aaggagctcggcatcacagcgcaggaactgaaccgctcgctctgcgccctgcatatccag
tattaccagagcggtcagtatctcctctatgccgattatgcccacatggtgacagtatcg
gcgaatcggtaccactgtagcgcatga