Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|537011.5.peg.3622 antirepressor, phage associated [Prevotella copri DSM 18205]
gtgtatcagctagttaacccacatgatgctgtaaaacacagcataagggtaacgactggt
atcaagaaggatggaagtgaggcaaagcgctggtgccagcttcttttcgtcaacgagagc
ggattctatgctttggtgctcgggtccaagcttcctacggcggtgaagttcaaaaactgg
gttacttccgaggtgctgccgcagattcgcaagacgggcggttatattccggtaaagcag
ggcgagagtgatgaggagacgattcggcatgctgaagagattctcagggctacactcaag
gagaaggagaatctgctgaaaaaccagcaggtgcagattgatcagcagaagaaactcatc
ggagaacaggatacggagattcgtcggctgaacggtgtggtagacgaacaggtggtttgc
atcgccaagaacggtgagaacatcatccagttggagaatcaggtggatcatcttctgccg
aaggcgctctacaccgacaatgtgctcaactcagtttcctgctataccaccacgcagatt
gcgaaggagctgggtatcacggcacaggagttgaaccgccagctctgtgcccttcatatc
cagtactaccagagcggccagtatctgctctatgctgattatgcccacatgggcctggcg
aagagccgcacccgctactctacccaccccgaccctcactgcgatggggcacaggagaag
ctgggcaccgcctacacccacacctacctcgtatggacagaaagaggaaggaagttcata
catttaaaggtaaaagggtaa