Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|536232.3.peg.2434 Phage antirepressor protein [Clostridium botulinum A2 str. Kyoto]
gtgagtaacttacagatttttaaaaatcaacaacttatagcacttaatcaaaataaaaat
ggagaagtgataataagtggtagagaattacatgagtttttagaaataggaactcaatat
acaaagtggttcgaaagaatgaaagaatatggttttgttgaaaatcaggactttgcaact
attagtcaaaaaagactaacagctcaaggtaatgaaacgacttatacagatcatgccata
aaattagacatggcaaaagagcttgcaatgatacaaagaaatgaaaaaggaaagcaagca
agacagtattttatagtggtagagaaagcatggaatagccctgaaatgataatgaaaaga
gcgctagaaattgctaatagaaatgtacaaaatttaaaactagaaaatgaagaacaaaag
cagcagcttaaaaagcaaaaacccaaagtactatttgcagatgcagtatcagttgcacat
acatcaattctagtaggagatttagcaaaattaattaagcaaaatggtatagatatagga
gctaaaagattatttgcttggttaagggaaaacggatacttaattagaagaaaaggaaca
gattataatatgccaactcaatatagtatggacttaggattatttgaagttaaggaaaca
tctattacacattcagatgggcatataagtataagtaagactccaaaaattactgggaaa
ggccagatatattttataaataagtttgtagaaaaacaaactaaaagcgagatagcttgt
actaaatag