Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|527027.3.peg.3738 FIG01247337: hypothetical protein [Bacillus thuringiensis serovar pakistani str. T13001]
atgacaccgcctacgataaatgctttactgcaagatcctgatttattgattagccttgcg
tcacaattgaaagacgaacaacaagccagacatatggcggaacaaaagaatctgatgtta
acccagcagattgcagaaaatgaatcaaagatgacatacctcgatcaaattcttcaatca
aaagatacagtaaccgtttcacaaattgcggctgattatgggttatctgcagttcgatta
aataaaatcttaaaggatgaaaaagtacagtacaaagtaaacaatcaatggctgctgtat
gcgaaacatcaaaataaagggtatacaaaatcgcagacaattgatgtcacgcattcggat
gggagtaaatctgtaaaaatgaatacacgctggacacaaaaaggtaggttgtttatccat
gatatgttaacaaaacgaggaattattccggaaatggataaggaggcggtataa