Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|527000.3.peg.1495 Phage antirepressor protein [Bacillus pseudomycoides DSM 12442]
atgatgaataacttactagtgtttgaccatgaagaattaggacaagttagaagtatcaaa
caaggagaagaaatttactttgtagctaaagatgtatcagacattttagagtttagggac
gcatacaccgctactagagggctggacgatgatgaaaagctcttacacacaatttatgta
gcaggtcaaaacagagaagtaacacttattaacgagtcaggtctctacggtttaattcta
acgagtcgcaagccacaagctaaagcctttaagaaatggattaccagtgaggtgctacct
agtatccgtaaagatggtggctatcttgtaacaactgaggaagatgatgaacaagctatc
atggctaaagcgttattgctagctcagagaacactcgaaagaaagaatgtacaacttaag
caagctgaggagactattaagatacaagttccaaaggttgaatacactgacaaggttctt
tccacagaaggatactacacagcaaccgaggtagcaaagatatttggtatgcgatcacct
caagggttgtataacaagttagtggataagaaaattatctataagagcagaaaaaagaat
tacctccacaaagcagagtattcattcctaagagatgagaattacatcagataccaaact
acagcgttcggacttcaaatgttgttctccgagttgggacgctattggattgctcaacag
ttaggaattattactcagtaa