Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|526998.3.peg.5622 hypothetical protein [Bacillus mycoides Rock1-4]
atgtttaatatcatagaatcaaaactaggtaacatcagaacttatgagattaatggagtc
aaacggtttgttgcaaaggatatcttaacagacatcattggatacaaaaacataacggat
gctttaaagaaggttaataataaagaaatcaacactatacagatgcctggaggatttaaa
attgtggttttaacttctgaaggactcaaacagttctttaatgatacaaaatctaaaaaa
gaaaagtttaaaacgatgaaagagtgggctatcgagtcaggattaattcctaaacaggag
gacaagccagttatcaccaagttaccagctctaggggaagtatttaataactcagagttt
ggcgaactagaggtgctagaaattgatggtaaaccttggttcccagctatagagtgcgct
gagattttgatttacactaatcctcggaaagctatgagagaccactgcttaagtgagggg
ataacaaatcgttccgtccttaccgaaggaggaaatcaagaaaagaaatacatcaacgag
gacaacctgtatcgcttaataatcaagtcaaaactacctagtgctcaaagcttcgagaga
tgggtatttgatgaggtgctactgagtttacgacaaaataaaggttatgtagttgagact
agcgagattgagtttatcgagaaacactttacagggttatctgataatctaaagagaatg
atggttatggagttaaatgagaataacaagaagttacacgaagagattaagcaaaagaac
aatatcatctcagtattacagccaaaagcaaacttctga