Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|526218.6.peg.1352 Phage antirepressor protein [Sebaldella termitidis ATCC 33386]
atggataaacttcaaatatttcaaagtaaagaatttggaaaagtaagaactgtattgata
gaaaatgaagtctggtttgtattaattgatatatgtaagatattagaactttcaaatcca
agtagtgtgatcaaaagattagatgaggacgaggtgactaagtttgacttagggagctta
tcagggattaccaatatcattaatgaaagcggattatataaagtaatttttagaagtgac
aaacctcaagctaatcaatttactaaatgggtaacccatgatgtattaccttcactaaga
aaaactggcagctactcaataaaccaaacaccaaaagaacttgaactaaaagaaaaagaa
atccaacttaaaactgctgaatttcttaataatatggctgacagtattctgattcctgaa
tacaagcagatacttaatgctcatgctactaaggtactaaccggggattttctacttcca
ttacctgttgttggtgaaataacctatagtgctactgaaattggcaaaatgcttaatatc
tcagctaatatggttggaagattaactaaaaagcataatctccgtactgaagaatatgga
aaagtcttttatgacaagtctaagtattccagtaaggaagttgagactttcaggtattat
attaaggttattgatattttaaagaatattgttagcactctatccgcataa