Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|525368.3.peg.2091 hypothetical protein [Mycobacterium parascrofulaceum ATCC BAA-614]
gtgagcgccgtcgagctgttcacctacgaagagaccgcccagatccggaccgtcaccatc
gacgagcgccggtgggctgtcgccgccgacatctgcgccgcgatcgacatcagggacgtc
tccgctgcgatagcgaagctggaccagcgggacaagatggttatccgcaggtcagatact
ccgggttcaaaccagggtatctggcagcaaatctcaccccgagttcagtcgatcggcctt
gtctccgaagacggcgcgactgacctcgtgctcgagtcacgcaagcccgaggcccgcagg
ttccgccgattcttgacccatgaggtatggccggcgatccgcgacaccggctcctactcc
accgtccccacgctcaccgacgacgaactgatccaccgcgcgctcgaagtcagcgcgcgc
cgcgtcgccgagctgaccgaacgcgtggccgaactcgaaccccaagccgcggtggcgacg
aagctcctcgacgctgaaggcgacctgtctgtgcgcgacgccgcgacgtcacttacccgt
gccggcatcaagattggcgctggccgattgttcgccgaactggaacgccgaggctggatc
aaacgcgccctcggcgacggccggtaccgcgtcatgcagaaggcgatcgaaaccggctac
atgtcagtgctgcctcagtctcactatcacccgaagacgggcgtcctggtccttgatccg
ccgcagccacgtgtgactcccaagggcttgcagcggttactcggcgactacgacaagggc
ggtagtcggtga