Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|525254.4.peg.1297 Phage antirepressor protein [Anaerococcus lactolyticus ATCC 51172]
ttgtattcacttatcctctcatcaaaactaccacaagcaaaaatattcaaagcttgggta
actagagaagttttaccgagcattagaaaaaatggaggatatatagctggtcaagaaaag
aaaactaacgaagagctacttgcagatgcaattctagtagccaatagaattattgccaaa
agagaagaagaaattgaagtattaagaccaaaggcagactattatgacaaattagtagat
tataatctacttacaaactttagaaacactgctaaagagttaggaataccacaaaatcaa
tttataagttttctaatggataagggattaatttatagagataagaaaaagaaacttcta
ccttatgcagataagaacaagggatattttgaagtaaaagaatgggttgaccctctaggt
acacttgtaggcatacaaacatttataacaccaaagggaagacactacctactaatttta
ttagatagtgaaggtttctacgatgaataa