Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|515621.3.peg.1992 Phage antirepressor protein [Clostridium botulinum Ba4 str. 657]
atgaataacttacaaattttcaataatcaagagtttggattagtaagaacaatacaaaaa
gaaaatgcaatttggtttgtaggaaaagatgttgctaaatgtttaggatatgaaagacca
acaaaagcaatacaagatcgagtagataatgaggataaagatgaagtcccaattcaggat
tccataggtcgaaaccaaaatacaccaataataaatgaaagtggactttacagtttagta
ttaagttctaaactatcaacagctaagaaatttaaaagatgggttacttctgaggtacta
ccacaaataagacaaacaggcgggtatattccacagaatgagaatgaaacagaagaagac
atactagccaaggctatattaatagcacagaagaccatagaaaagaaaaacagaataata
gaagaacaaaaaccattagttagtttcgctaataaggtagcaacatcacaaaatagttta
cttgttagagaagttgcaaagttagctagtaaagaaggaataaacataggagaaaaaaga
ctatggaacaagttaagagaatggggactaatatttaaaaacactacagagccaaagcaa
tacggaatagacagaggatattttgaggttgtagaaggtactagagaaaataaaacagga
acatttatctacaaaacaacacgtgttactggcaagggtcaagtttatataatatcaaga
ttagaaaaagaattagcatag