Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|487214.3.peg.62 Antirepressor [Streptococcus pneumoniae Hungary19A-6]
atgttcgtcttgaacaattgctggaggaataacatgaacgaactcatcaacgtaaccctg
aatgacaatcaggagccagtagtgtcaggaagacaactacatgaggcgctgggtgttaat
tcaagatatacaacatggtttgaccgtatgaaggaatacggatttacagaaggtcaggac
tttctcccaaatttgggaaaaagtacaggagggcgacaagctactgaccacatcatcaag
ctagacatggccaaggaaattgctatgatccagcggacggagagaggcaagcaagtccga
caatactttatccaagtagaaaaagactttaatagccctgagaagattatggcaagagca
ttgctcatggctgatcagaaagtccacaagctggaggctcagattgaagcggacaaaccc
aaagtcctctttgcagacgcagtaagtgcaagccatacatctatcttggttggcgaactt
gccaagctcattagccaaaacggctacaaaatcggtgccaatcgcctcttttcttggatg
cgcgaaaatggctacctgattaagcgcaaaggctcagattggaacatgccaacccaacgt
agcatggacttgaaactctttgaaatcaaggaaacaaacgtgcaacacgcagatggacat
atcactgtgaacaagacaccaaaggtcacaggcaaaggacaacagtattttatcgataag
ttccttaattag