Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|485916.5.peg.1893 Phage antirepressor protein [Desulfotomaculum acetoxidans DSM 771]
atgactaacgcattagctattacaaacgaaatgaacaggattcaaagggtatttaattat
gagggccaaaaagtgcggacggtactgataaatggtgagccttggtttgttggagtcgat
gtatgtaatatattggaaataaataatagtcgtcaagctatttcatacttagatgttgat
gaaaaacagacaataccgtcccggagtttgaccgtcattaatagtgacagtcaaaaaggt
ggagcacagtatattaccataataaacgaaccgggcttatattctttaattcttagaagt
cgtaaaccagaagcaaaagcattcaaacgctggatcactcacgaggttattccctccatt
cgcaaaacaggggcatatgaaatgccgggaattgttaaagactatttggccatgtcagaa
gaagatcgggcgattgcgttttttaaaaagtcgaaggaatttaaagtcttggaagcagag
aataaaattttaaaacccaaggccggtaaatatgacgacttcttgaacagcgatggagta
ttcgattgggacgcaatttcaagcaccttggatataggaagaaacacaatgcttcttgaa
ctccgggaaagaggttacttacaaaagagaaagggtaataactggaacttagctctccgc
cgctacgaggaagctggttggttcgtgacaaaggccgttagccagtggacagataaattt
ggcaatgaataccccaaatataaaacatttgttactccaaccgggctggataatttaatt
gagctgttcaggaaatgggggtattaa