Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|485916.4.peg.771 Phage antirepressor protein [Desulfotomaculum acetoxidans DSM 771]
gtgcggacggtactgataaatggtgagccttggtttgttggagtcgatgtatgtaatata
ttggaaataaataatagtcgtcaagctatttcatacttagatgttgatgaaaaacagaca
ataccgtcccggagtttgaccgtcattaatagtgacagtcaaaaaggtggagcacagtat
attaccataataaacgaaccgggcttatattctttaattcttagaagtcgtaaaccagaa
gcaaaagcattcaaacgctggatcactcacgaggttattccctccattcgcaaaacaggg
gcatatgaaatgccgggaattgttaaagactatttggccatgtcagaagaagatcgggcg
attgcgttttttaaaaagtcgaaggaatttaaagtcttggaagcagagaataaaatttta
aaacccaaggccggtaaatatgacgacttcttgaacagcgatggagtattcgattgggac
gcaatttcaagcaccttggatataggaagaaacacaatgcttcttgaactccgggaaaga
ggttacttacaaaagagaaagggtaataactggaacttagctctccgccgctacgaggaa
gctggttggttcgtgacaaaggccgttagccagtggacagataaatttggcaatgaatac
cccaaatataaaacatttgttactccaaccgggctggataatttaattgagctgttcagg
aaatgggggtattaa