Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|471872.6.peg.1268 Phage antirepressor protein [Streptococcus infantarius subsp. infantarius ATCC BAA-102]
atgaatgagttaattcgtatagatttcaaaggtgatagtgctactgtctcggctcgtgac
ttatatagaagtttagaggttaaaactcgtttcagtcagtgggtcgagcaaaacttcaaa
atgtttaaagagaacgaagattttagctctgtagttacaactacacagcaaaatcaatat
ggcggagttaaaaaattacaagattacgctgttagtattcgcatggctgaacatttagca
atgatgtctaaaacttcaaaagggtacgaagtcagagaatacttcattcaagttgaaaag
gacttcaacagtcctgagaaaatcatggctcgagctcttaaaattgctgaccgtaaaatt
attaaacttgaagcaacaattgaagagcaaaaacctaaagttatctttgctaacgcagtc
agcgcaagtcatacgtctattttagtcggtgactttgctaagctcatgcgtcagaacggc
ttgaattttggtcagaatcgtatgtttgcatggctgcgagaaaatggctatctaatcagt
cgcaaaggcaaaagttggaacatgccaacacaaaaagcaatggatttaggtctgtttgaa
atcaaagaaacgactatcaatcattcagacggtcatatcagcattaacaagacacctaaa
attacaggtaaagggcaattgtattttgctgataagctactgaataacattgcttaa