Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|469605.3.peg.258 FIG00670543: hypothetical protein [Fusobacterium sp. 3_1_5R]
atgaaaaaaagattgaaagtgtttgaaagtggtaattatcctcaaggaaattttgaagca
gacagagtgaaagctgtttttgaaaaagttgtggataaaattccgggtatttttgcccac
agttcacattgggcaaagaaagaagaagaacctgtttcagttggagaattctctaatttc
gaacttttgaataaaaatggaaagttggttgtatttggagatgtagagttcaatgaaaaa
ggagcaggatattacaatgacaagattttggagggagtatctgtagaaatagatcctaag
acaaatactttacacaaaattgcagtattgccaaagggtgtaaaaccacaggttgctgga
gcggaatttgagttaaaagaagatgaactacaagggatttatttacaatttgaagaattt
gaggaggaaaaaatgacactagaacaaattatggcaacattcccagttctttctttagac
gacagagcaaaattaatcaatagtttggtttcgactgttactgatgaagaaagaaacgga
atgagaaagcttatggaatgggaaaaagtggaagcaattcaagtagaaccgaaagttccg
aaaacagaagatgaaattcgagcagaaatcacagctcaaatggaatttgaagcaaaaaga
aatcaattgattgaaaaggcaaaagcaaaattcactccagcacaacaagaaatcatggaa
tttgcattaaaaaaagcaggagaagaaagaacaactgttttagaatttgaatctaacgga
aagaaagaaaatatgtcttattttgaaagatttgaaaaagcggtagaaacaatggaagac
gctgctaattttacaagcaagacaaaagaattagaatttgaaaacaaagaagaaaaaaca
gatgcaatgaagcaagcttatgatagaacaaaagctagattttcaaaatga