Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|452948.4.peg.2055 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase (EC 2.2.1.9) [Staphylococcus aureus 930918-3]
atgggaaatcataaagcagctttaacgaagcaagtttttacatttgcatctgagttatat
gcgtacggcgtaagggaagtagttatcagtccgggatcacgctcaacgccacttgcactt
gcatttgaagcacatccaaatattaaaacatggatacaccccgatgagcgaagtgcagcg
ttttttgcagttgggttaattaaaggcagtgaaagacctgtcgctatattatgtacgtca
ggtacagcagcagcgaattatacgcctgcaattgctgaaagccaaattagtagaattcct
ttaatcgttttaacaagtgaccgtccgcatgaattaagaagtgtaggcgcaccacaagcg
attaatcaagtaaatatgtttaataattatgtaagttatgagttcgatatgcctattgcg
gatgatagtaaagagaccattgatgcaatttactatcaaatgcaaattgctagtcaatat
ttatatggaccacataaagggccaattcattttaacttgccatttagagatccgttaaca
cctgatttgaatgcaacagaattgttaacttctgagatgaagattttaccgcactatcaa
aaaagtatagatgcatcggcattaagacacattttaaataagaaaaaaggtttaattatt
gtaggggatatgcagcaccaagaagttgatcaaatactaacgtattcaacgatatatgat
ttgcctattttagctgatcctttaagtcatttaagaaaatttgatcatccgaatgttatc
tgtacatatgatttgctgtttagaagcggcttagacttaaatgtggatttcgtaattcgt
gttgggaaaccagtgatttctaaaaagttaaatcaatggttaaagaaaactgatgcattt
caaatattagtgcaaaacaatgataagattgatgtctttccgatagcgccagatatttca
tatgagatttctgcgaatgatttctttaggtcattaatggaagacacgacagttaatcgc
gtaagttggttagaaaaatggcaatgcttagagaaaaaagggcgtaaagaaattaaatgt
tatttggaacaagctacagatgagagtgcattcgttggtgaattgattaagaaaacatct
gaaaaagatgcattatttattagtaatagtatgcctatcagagatgtagataacttgtta
ttgaataaaaatatagatgtctatgcgaatcgtggtgcgaatggtattgatggtatcgtt
tcaactgcactgggtatggctgtgcataaacgaataacattattgataggtgatttatca
ttttatcatgatatgaatggactattaatgtcaaaattaaataatattcagatgaatatt
gtattattgaacaacgatggtggcggtattttttcatatttaccacaaaaagaaagtgca
actgactattttgaacggttgtttggcacaccgacgggattggatttcgagtatacagct
aagttatatcaattcgattttaaacgttttaacagtgtttcagaatttaaaaatgccaca
ttgttatctgaaacttcgacgatttatgaattgataacgaatcgcgaagataactttaaa
cagcatcaaattttataccagaaattgagtgaaatgattcatgacacattataa