Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|445972.6.peg.1965 Phage antirepressor protein [Anaerotruncus colihominis DSM 17241]
atgaatgacattatgaaaattgacggaatcgagtgctacgagaaggacggtacagcttat
ttgaagctggaggctgtcgcgcgtgggttgggttttaccgaaacaaaagacagtaaggat
tatgtgatgtggcgcagggtagacggatatcttgcaaatcttggtttcggcacttctgcc
gaaaggcccgatttcatccctgaaaatgtcttttacaggctggccatgaaggctaagaac
gaagcggccgaagcgttccaggctaagatcgcggacgaagtcatccccgccatccgtaaa
cacggcgcgtatatgacgcccgagacactggaggcggcgatcatgaacccggatatcatg
atcaggttatgcaccgcactcaagaatgaacaggagaagcgcaaagcccttgaaacagta
aattctgccctgacggtcgacaaccagatcatgcggcccaaagcggactatttcgacgaa
cttgtggaccgtaatctgttgacaaattttcgcgagacggcaaaacaactggagatcaag
gaaaagaatttcattggatttttgttggaaaagaagtatatataccgggataagcgcgga
aaactactgccctatgcggataaaaacaacgggctgtttgaggttaaggagtgtttcaac
gagaaaacacaatggagcggtacgcagacattggtcacgcccaaaggccgggagacattt
cgtttgctatatttaaggaataagtag