Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|445971.6.peg.353 Phage antirepressor protein [Anaerofustis stercorihominis DSM 17244]
atgaacgaaataaagatatttgaaaacagtgaatttggaagagtaagagttgaattaata
aataatgatatatatttttgtcttaaagatgtatgtgaggcactatcaattaccaataca
acaatggttgccaatagattagatgtagatgaagtgactaagttagatttaggcggtaaa
tcaggaagtaccaattttgtaaatgaaagtggtttatattctgttatattaagaagtgat
aaacccaatgcacaaaagtttaggaaatgggtaacatcggaaatattaccaaatatcaga
aaacacggagcatatatgaccgatgagacgcttgagaaagctctgttaagccctgatttc
cttatccagcttgctaatcaacttaaagaagcaaaagcattgaacagtaagctggcggta
gataatcaaataatgaagcctaaggcagattatttcgacgaactggtggaacgaaacaca
ttgacgaattttacggaaacggctaaggaactggggataaaaagaaaagtacttataaac
tttcttattaataaaaaatatatttacagagacaaaaagggtaagatacttccttatgaa
agcagaaataaaggatattttgagataaaagaaagcttcaacaataaaactgactggagc
ggagtacaaactcttataactcccagaggaagagaagcctttaagctcatgataacggga
taa