Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|445337.5.peg.2279 hypothetical protein [Clostridium botulinum C str. Eklund]
gtgaacatactaaaaaaatattttttattttatgttctccaaatgacacatgatatattt
aaatctgtacacgctgtgttatataatgaattttataatgaaaaagggggataa