Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|440497.10.peg.893 Phage antirepressor protein [Lactobacillus jensenii 1153]
ttgtcgcaaaacgctacgggctatcaaaatattgatttaattacggaatctggtgtttat
tcattaattttcggtagcaaattaccaactgccaagaagtttaagcactgggtaactagt
gaagttctacctgcaattagagaacatggcgcctatatgactgatgaaaaggcatttgat
gttgttaacaataaggcaggccttgcagatctattgcaacaagctgcagaccagctcaag
caaaaagatattcaaattgctgaaatgaagcctaaagcactgtttgctgacagcgtagca
acttcaaactcaacgattttagttggtgaattagctaagattttgcgaggaaatgggatt
gagattggtcagaacagattgttcgactggttgagaaagaatggctacttaatttccaaa
aagggtagtagttacaacctaccaactcagaaatctatgaacctcggtttgttcaaaatt
aaggaaacaaccattaatcactctaacggttcagtatcaatcagcaagaccgctaaagtt
actggcaaaggccagcagtactttattaataagttcttgaatgcagaagaacactcaggc
tacgtatttactggcgactctgaaacagaagtggtgctaactacaaataatgaacctatc
ttacattga