Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|431943.8.peg.1988 Phage antirepressor protein [Clostridium kluyveri DSM 555]
ttgagtaagttacaaatttttaggagcaaagaatttgggcaggtaagaactacatttata
aatggaaaaattcattttgtagctgtagatattgccagagcattaggatataaaaataca
aatgatgctattttaaagcactgtaggtgggtagcaaaatgcgaggtacctcatccacag
agtaaaaccaaagttatagaagtcaacgcaataccagagggtgatatttatagattggta
gcaaattctgaattacctggagcacaagaatttgaaagctggatatttgataaagtacta
ccacagataaatcatacaggtggttatataccaaataacgaggatgaatcagaggaagat
atattggctaaagctgttttgatagctaaaagaactattgaaagaaagaacgaaattata
gcagataagaataaacaacttcaggagcaaaagccaaaagtaatatttgcagaaagtgta
caggcatccactacaacaatcttgattgggcaacttgccaaaatattaaagcaaaatgga
attgacatgggacagaatagattatttgaatggcttcgtaaaaatggatacctgattagc
aggaagggtactgattataatatgcctacacaaaagtctgcgaatttaggattatttaca
acaaaggagacaactataggtcattcggatggtcatgtaagtatatctaccacaccaaaa
gtaactgggaaaggacaggtatattttgtgaataagtttaaggaattacaggaaggtgtt
agagaaaggcaggcgacaaaatga