Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|418127.6.peg.870 Phage antirepressor protein [Staphylococcus aureus subsp. aureus Mu3]
atgcaagcattacaaacatttaattttgaagaattaccagtaagaacattagaggttgac
ggagaaccatattttataggaaaagatgttgctgacattttaggatatgcaaacggacga
gatgctttgtcaaaacatgttgatgaagacgacaagaaagttctaacgtcgcgaaatacg
actttagaaaatttaccaaatcgaggacttactgcagtcaacgaatcgggtttatacagc
ctaatcttctcatcaaaactagaatcagctaaacgattcaaacgctgggtaacatcagat
gtcctaccagccattcgcaaatatggtatctacgcaacggacaacgtaattgaacaaaca
ttaaaagatccagactacatcattacagtgttgactgagtataagaaagaaaaagagcaa
aacttacttttgcaacaagaaatcggagagctaaaacccaaagcagattatgttgatgaa
atcttaaaatcaactggcacattagctacaactcaaatcgcggcagactacggtatatca
gcacaaaagttaaacaaactactacacgaagctagactacaacgaaaagtaaataaacag
tgggtgctttactcagaacacatgggcaagagttacacagattcagacactataacaatt
gtgcgttctgatggcagagaagacacagttttacaaactagatggacacaaaaaggcaga
ttgaaaatacatgaaatcatgactgaattcggttatgaagctaatttagggggagcgtaa