Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|412966.10.peg.114 Phage Rha protein [Vibrio cholerae 1587]
atgtctaaccaacttacttttcaaggcgtatacctaaccccaatcgagaaagaagctcag
ctatggctttctgctagtgatatcgccaatgctcttggctataaatccccgaaatcaatt
tctaacatttatgctcggtattcagatgagttttcgagtggaatgtctgaggtcatcaat
ttgatgacctcaggaaattaccaaaaatcagtacgcattttctcactgcgcggtgctcac
ctcattgcaatgttttcacgcacaagcattgccaaagagttccgcaaatgggtactggac
gttcttgataaacagatagaaacagcccaacctcagccactaaccttaaccagtgcgcaa
aagcttgaaatacgcaaagcggttggcaaaaaagcacttaatgatggcgaaagccacaag
cgtgtttatcatgctctgtacgatcattttagtgttagtgaatatggcgacattcttcaa
tctcagtttgatgaggctatagcctttatcaacagtcttgatgtaaggccaagactagcc
gacccaaaaagtacattgcctgttgtttgcatgcgcattatgacaaccattgaaaacggc
gttgtaacgaatagctctgccgttcccaatgatgcctatgttgtcacaaaaggaagatta
gcgaatctgctttctgaacctggtgttttctctttagaagagatggcaaagatcgcagaa
acggtaaatagaagaatggtcgagctggcaatgagtgccggaagaatgttaactgtaaag
taa