Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|411483.3.peg.483 Phage antirepressor protein [Faecalibacterium prausnitzii A2-165]
atgacggatttcaatcagaagacccatgacaccgatgtgggcagtcatggcggacagtca
aggcagatgatggaggtgtttgagaaccaggagtttggttcgatccgcgtgttgcaagag
gcgggcaagaccttcttctgtgcaagcgatgtggcgaaagcgttggggtatgtgaatccc
tacgccgcagtgaaacgccattgcagaggccccctaacgaaacgcgagggggtcgttcag
aaggtgaatcagtatggagatgctggagagcaggtcgttgaaatctcctttatcacagaa
ggcgatgtttaccggctgatcgttcacagcaagctgccatcggcagaacgatttgaacac
tgggtgtttgatgaagttctcccgtccattcgcaagcatggtgtgtatatgagcgattcc
attttggatcaggtgattcagcatccggaggtcatctacacactggcacaggagcttgta
gccgagagagagcagcttgagggtatccgcaaacagctggatgcggcacagcccaaggca
gactacttcgacacctttgtaaattcggaagattgcacctgcatccggaatttctgtaag
gaaatcggaatcccagagaagacggcagtagctctcttactggatcaccgctatctgtac
cgcagtccaagcggctggctgatgccttttgcagacaaatctgcaaggggctattttatt
gtccgggattgctacggcagaagtggaaaactggtgcagcagacgagagtgacctgcaag
ggaaagaatcatctctttaagttgtttaagaaatggggtgtgatcgaatga