Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|411471.5.peg.2535 Phage antirepressor protein [Subdoligranulum variabile DSM 15176]
atgaaccagatggaaattttcaaaaacccggagtttggggctatccgcgccgtagagatt
gacggagagccttggctggtcggaaaagatgtggcgttagcgttagggtataaaaatccg
caggaggcgatccgcaaccacgttgacgcagaggacaaaggggtgagcgaaattctcacc
cctggcgggattcagaaactccctatcatcaacgagtccggcctgtattctctggtgttg
tccagcaaacttcccaaagcaaagcagttccgccgctgggtcacgtctgaggtcctgccc
agcatccgccagcacggggcctacctcaccagggaaaaactgtgggaggtcgccacctcg
ccggaggcgctgctgaagctctgctccgacctgctggccgagcgcgagaagaacgcggcg
ctgcaagcggacaacgcccggctgcaaggcaaggccgtctactacgacctgtttatcgac
ctgcggcacagcaccaacctgcgcaccaccgccaaggagttggaggtgccggagcggcgc
ttcgtccgtttcctgctggaacgccggtacgtttaccgcgccccctccggctgtgtgctg
ccctacgccaagagcgccaacgaggggctgttctgtgtgaaggatttttgccgcaacggc
cacactggctcctacacgctggtgacgcccaagggcaagctgcactttgcagaactgcgg
tcgctgatcctggtgacggtatga