Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|405440.3.peg.1074 Phage antirepressor protein [Xylella fastidiosa M12]
gtgggggtgaatcggattcacaccactggcagcacacgaaacggcagggccgagaaacgc
gcgccctccaccggcttgcatcgtaaggacaacatcatgaatgcaccctctgagttcact
ctccagtttgaatcccacgccgtgcgtgtccagctcgacgaacacgagcggcgatggttc
aacgccaatgacatttgcgcggcgttggagttgttaaatccgcgtgctgcacttgctcag
catgtgggtgccgagaatgtatcgaaacgcaaaaccatcgacgccgttgggtggactaag
cacgccaactatttgaacgagtcaggggtgtacgccttgctcatcggcagcaccaaagag
gcggctaaacgctttagacagtggctgaccgatgaagcgctgcccgcagctcaaaaagca
gggcatcacatcatccctctgcacagcgcaatcgacagtgcgccttccgtcccaagcccc
ttccaacacacagagaaccacacaatgaacgcaatcactccattccaattcgaatcaaaa
gatgtgcgtattcagctcgacgaggccaatgcgccttggtttaacgccaatgatgtttgt
gccgttctggagtttggcaatccacatcaagccattgaatcccacgtggatgtagaggat
ctccagaagttggaggcccctacagcaggtggccgtcaacgcgttaaccacatcaacgaa
tctggtttgtactccctgatcatgggcagcacaaaacctgcggccaagcgttttaagcgt
tgggtgacgagcgaagttctgcccaccctgcgtaagacaggcacctactccacaccagga
gcactgcccaccttgcctgggccgacacaggatcgcattgccgcgcttctgttaatcggc
caatacatctccacggtgccagggatgaagccagggattgctgcggcggcaacgctggcc
tgcatcaaaagcaacacgaatttaacaaccgaagagctacgccgtgcattgcctgcgtta
caggaaccgctttgcctgctcaacgccacgcaactaggcaagcagctgcattgctcggcc
aaggcggcgaaccaattattagcctccagtggctttcagttccgtaatgaacgcgacgcg
tgggaattaaccgaagccggtcgcatgtggggtgaagcgattccgtactcacgcaacggg
cacagcagctaccaaattctttggaacccaacggtgcttgactcgctgaaggtagccgcc
tga